Эндометриоидная опухоль яичника


Эндометриоз и эндометриоидный рак яичников Текст научной статьи по специальности «Клиническая медицина»

РАК ЯИЧНИКОВ

Энлометриоз и эндометриоидный рак яичников

Ю.Г. Паяниди1, К.И. Жорданиа1, В.И. Логинов2, Г.Ю. Чемерис1, Н.Г. Сивакова1

1 ФГБУ «Российский онкологический научный центр им. Н.Н. Блохина» Минздрава России, Москва

2 ФГБНУ «Научно-исследовательский институт общей патологии и патофизиологии», Москва

Цели исследования - определить природу происхождения (первично-множественные или метастатические) синхронных эндометриоидных злокачественных опухолей тела матки и яичников, а также выяснить роль эндометриоза в канцерогенезе эндометриоидного рака яичников.

Материал и методы. Проанализированы клинико-морфологические характеристики больных синхронными эндометриоидными первично-множественными злокачественными опухолями яичников и тела матки (п=66) и больных эндометриоидной аденокарциномой тела матки и яичников (п=50). Для уточнения их клонального происхождения, а также для выяснения роли эндометриоза в канцерогенезе эндометриоидного рака использовали молекулярно-генетические технологии.

Результаты. Несмотря на существенные различия в клиническом течении заболевания, а также в морфологических особенностях опухолей у этих двух групп больных, результаты проведенных молекулярно-генетических исследований показали, что в 100% наблюдений эндометриоидные опухоли имеют единое клональное происхождение и соответствуют раку тела матки с метастазами в яичниках.

Заключение. Исследование показало, что возникновение эндометриоидного рака яичников и рака тела матки связано с эндометриозом.

Ключевые слова:

эндометриоз, эндометриоидный рак яичников, рак тела матки

Endometriosis and endometrioid carcinoma

Yu.G. Payanidi1, K.I. Zhordania1, V.I. Loginov2, G.Yu. Chemeris1, N.G. Sivakova1

1 N.N. Blokhin Russian Cancer Research Center, Moscow

2 The Institute of General Pathology and Pathophysiology, Moscow

Objectives. Objective of the study was to determine the nature (multifocal or metastatic) of synchronous endometrial uterine body and ovarian neoplastic tumors, as well as to clarify the role of endometriosis in endometrioid ovarian cancer carcinogenesis.

Material and methods. We analyzed clinical and morphological characteristics of patients with multifocal synchronous endometrial uterine body and ovarian neoplastic tumors (n=66) and patients with uterine body and ovarian endometrioid adenocarcinoma (n=50). For greater certainty of their clonal origin as well as identification of the endometriosis role in endometrioid cancer carcinogenesis molecular genetic technologies were used.

Results. Despite significant differences in the clinical courses of the disease, as well as morphological characteristics of tumors in these two groups of patients, results of molecular genetic testings have shown that in 100% of cases, endometrioid tumors have common clonal origin and correspond to uterine body cancer with ovarian metastases.

Conclusion. The study showed that endometrioid carcinoma and hysterocarcinoma occurrence was associated with endometriosis.

Keywords:

endometriosis, endometrioid carcinoma, uterine corpus cancer

Впервые патогенетическую связь эндометриоза и рака яичников (РЯ) отметил J. Sampson еще в 1925 г., обнаружив клеточные элементы эндометриоза в опухолях яичников [1]. В конце 1970-х гг. много внимания изучению этого вопроса уделял Я.В. Бохман. Он высказал вполне обоснованное предполо-

жение о том, что частота озлокачествления эндометриоза, по всей видимости, значительно превосходит официально представленные в литературе данные, поскольку невозможно проследить весь механизм трансформации от структур эндометриоза до инвазивного эндометриоидного рака, так как в большинстве случаев злокаче-

ственные новообразования яичников диагностируются на поздних (III-IV) стадиях, когда опухоль практически полностью замещает орган, в котором она возникла, и поглощает ткани, ей предшествовавшие [2].

Исследование, выполненное в Швеции с участием 20 686 больных эндометриозом (время наблюдения -11,4 года), показало, что риск развития РЯ был примерно в 2 раза выше, чем в популяции [стандартизированное отношение частоты - standardized incidence ratio (SIR) -1,9; 95% доверительный интервал (ДИ) - 1,3-2,8]. Особенно этот риск возрастал (SIR - 4,2, 95% ДИ - 2,0-7,7) у женщин с длительно протекающим эндометриозом яичников [3]. В целом у больных эндометриозом риск развития РЯ был на 20% выше, чем в популяции, а, по данным A. MeLin и соавт. (2006), даже на 37% [4].

Опираясь на данные мировой литературы, можно отметить, что РЯ, развившийся у больных с эндометриозом, в 40-55% наблюдений представлен эндометрио-идной аденокарциномой, в 20-40% - светлоклеточной, серозные и муцинозные подтипы рака выявляются реже (<10%) [5]. Кроме того, накопилась информация о частом сочетании эндометриоза со злокачественными новообразованиями эндометрия, молочных желез, толстой кишки и даже желудка, особенно если ранее эти органы были скомпрометированы (в анамнезе хронический спастический колит, гастродуоденит, язвенная болезнь желудка) [5-7].

МАТЕРИАЛ И МЕТОДЫ

За последние 10 лет в ФГБУ «РОНЦ им. Н.Н. Блохина» Минздрава России из 1062 больных раком яичников эн-дометриоидная аденокарцинома была выявлена в 85 (8%) наблюдениях. При этом эндометриоидный РЯ в 90% наблюдений сочетался с патологией эндометрия: в 8,2% - с атипической гиперплазией и в 77,6% - с эндометриоидной аденокарциномой тела матки. Естественно, возникает вопрос: являются ли синхронные опухоли эндометрия и яичников первично-множественными злокачественными новообразованиями (ПМЗН) или это метастазы тела матки в яичниках? Для выяснения этих аспектов мы провели комплексное обследование больных с эндометриоидной аденокарциномой яичников и тела матки (n=116), разделив их на 2 группы. 1-ю группу составили больные, у которых по морфологическим критериям были поставлены диагнозы «первично-множественный синхронный рак яичников» и «рак эндометрия» (n=66). 2-я группа был представлена больными раком эндометрия с метастазами в яичниках (n=50). На первом этапе исследования мы сравнивали клинико-морфологические особенности больных этих групп. Затем оценивали эффективность использования молекулярно-генетических технологий для анализа клонального происхождения множественных опухолей репродуктивной системы женского организма (тела матки и яичников). На основании полученных данных планируется подтвердить или опровергнуть предположение, что предшественником некоторых форм рака яичников является эндометриоз.

Для проведения молекулярно-генетических исследований был получен материал от 20 женщин с диагностированным синхронным эндометриоидным раком яичников и тела матки.

Образцы тканей были подвергнуты препаративной микродиссекции с выделением пораженной и интактной областей, из которых в последующем выделяли ДНК. Молекулярно-генетическое разнообразие в опухолевых и нормальных тканях исследованных органов изучали, анализируя мутации гена К-ras (12-й кодон), потери ге-терозиготности (LOH-анализ). Кроме того, у 10 больных определяли экспрессию ARID1A в очагах эндометриоза.

Для амплификации K-ras-фрагмента (157 п.н.), содержащего 12-й кодон, использовали следующие праймеры:

5' ACTGAATATAAACTTGTGGTAGTTGGACCT 3',

5' TCAAAGAATGGTCCTGGACC.

Рестрикционный анализ продуктов полимеразной цепной реакции (ПЦР) проводили с помощью эндонукле-азы MvaI в условиях, рекомендованных производителем (Fermentas). Продукты рестрикции выявляли на поли-акриламидных гелях после окрашивания их серебром.

Анализ потери гетерозиготности (LOH-анализ) выполняли с использованием полиморфных микросателлит-ных маркеров для аллелей D3S4614 (3p21.31), D3S4604 (3р21.31-р21.2) гена RASSF1A и аллелей D17S578 (17p13) и D17S1353 (17р13) гена р53.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

С клинической позиции, по данным мировой литературы, больные солитарным раком яичника или эндометрия преимущественно находятся в менопаузе и относятся к возрастной группе 60-70 лет, в то время как возраст больных синхронными ПМЗН эндометрия и яичников составлял 40-50 лет. В нашем исследовании синхронный первично-множественный рак тела матки и рак яичников чаще всего встречался у женщин, средний возраст которых составил 48,7+2,4 года, но 12% больных ПМЗН были моложе 40 лет. Более чем у половины пациенток (57,9%) на момент выявления опухолей была сохранена менструальная функция. В 22,7% наблюдений в анамнезе было бесплодие.

Наибольший риск метастатического поражения яичников у больных раком тела матки наблюдался в возрастной группе от 51 года до 60 лет (средний возраст -56,2+3,4 года). Все пациентки находились в менопаузе (средний возраст наступления менопаузы - 50,9+2,1 года). Бесплодие было отмечено в 9,3% наблюдений.

При изучении гистологических критериев синхронных ПМЗН тела матки и яичников мы установили, что в большинстве наблюдений у таких больных выявлялась вы-сокодифференцированная аденокарцинома тела матки (52,6%) с экзофитной формой роста (71,1%), ее размеры редко достигали 5 см (10,5%), глубина инвазии миоме-трия не превышала 0,5 см (78,95%). Опухоль эндометрия сравнительно редко (10,5%) переходила на цервикаль-ный канал при глубине инвазии <1 см. При этом нельзя

не отметить, что в этой группе больных в 40,0% наблюдений были выявлены ранние стадии рака яичников (1а-11а).

В отличие от этой группы больных метастазы рака тела матки в яичниках чаще всего выявлялись у более пожилых женщин в менопаузе (100%). В большинстве случаев у них наблюдался местнораспространенный опухолевый процесс, при котором опухоль эндометрия, представленная преимущественно аденокарциномой с плоскоклеточной метаплазией (36,5%) или низкодифференци-рованной аденокарциномой (25,4%), имела смешанную (51,2%) или эндофитную (28,8%) формы роста, занимала всю полость матки и переходила на цервикальный канал (53,7%), ее размеры превышали 5 см (48,8%), а глубина инвазии в миометрий составила >1 см (56,1%).

Сравнительное сопоставление выживаемости при синхронном первично-множественном раке яичников и раке эндометрия с выживаемостью больных раком тела матки с метастазами в яичниках показало, что для 1-й группы больных характерно более благоприятное течение заболевания. У них реже развивались рецидивы -в 12 (31,6%) наблюдениях, а 5-летняя выживаемость достигает 66,2%.

Общая 5-летняя выживаемость больных раком тела матки с метастазами в яичниках составила 32,2%. Срок, к которому погибла половина больных, соответствовал 39,3+3,2 мес (р<0,05).

Как показали наши исследования, клиническое течение заболевания, а также морфологические особенности опухолей в обеих группах больных имеют ряд существенных статистически достоверных отличий. Для уточнения клональности, а также для выяснения роли эндометриоза в канцерогенезе некоторых форм рака яичников мы использовали молекулярно-генетические подходы.

Мутации, затрагивающие 12-й кодон гена К-ras, относятся к однонуклеотидным заменам. Эти мутации приводят к исчезновению сайта рестрикции для эндонуклеазы Муа1 в одном из аллелей гена, что и было использовано для ее детекции. При рестрикции ПЦР-продукта размером 157 п.н. при отсутствии мутации имеются 2 сайта для эндо-

100 90 80 70 60 50 40 30 20 10

2 3

Время наблюдения, годы Рак тела матки с метастазами в яичниках Первично-множественный рак

Рис. 1. Выживаемость больных с первично-множественными злокачественными новообразованиями тела матки и яичников и раком тела матки с метастазами в яичниках

нуклеазы, что приводит к образованию 3 фрагментов (114, 29 и 14 п.н.). При мутации вследствие исчезновения одного из сайтов рестрикции образуются фрагменты 143 и 14 п.н. В научной литературе описаны сравнительно часто встречающиеся в популяциях варианты участков генов, не приводящие к заметным нарушениям функций, которые обычно рассматриваются как нейтральные мутации или генетические полиморфизмы (SNP). Обычно генетические полиморфизмы не нарушают генетическую активность, тогда как мутации, как правило, ассоциируют с теми или иными генными болезнями. Вместе с тем некоторые генетические полиморфизмы, особенно внутригенные или находящиеся в регуляторных сегментах гена, отнюдь не являются функционально нейтральными. В случае SNP в регуляторной области возможна активация спящих генов, что может стать толчком к развитию рака. Таким образом, генетические полиморфизмы и мутации - явления одного порядка; грань между этими понятиями весьма условна, как зачастую условно разделение понятия нормы и патологии [8].

Для LOH-анализа сравнивали интенсивность аллелей высокого (H-аллели) и низкого молекулярного веса (L-аллели) в соответствующих парах опухоль/норма. Случаи с уменьшением интенсивности одного из аллелей на 50% и более рассматривали как LOH.

Экспериментально легко выявляются 2 варианта геномного полиморфизма: количественные изменения в области локализации мини- и микросателлитных последовательностей ДНК и качественные замены отдельных нуклеотидов, приводящие к появлению полиморфных сайтов рестрикции. Гипервариабельные сателлитные повторы гораздо более информативны по сравнению с полиморфными сайтами рестрикции, так как представляют собой мультиаллельные системы с уровнем гетерозиготно-сти, достигающим 70-90%. Кроме того, оказалось, что количество высокоизменчивых мини- и микросателлитных последовательностей в геноме человека, по-видимому, превышает несколько десятков тысяч, они достаточно плотно и равномерно расположены в каждой хромосоме. Так, >90% из 5000 идентифицированных C-A-повторов являются полиморфными, причем в большинстве из них уровень гетерозиготности значительно превышает 50% [9]. Общее число высокополиморфных мини-сателлитных последовательностей в геноме превышает 1500 [10, 11].

Характерная для опухолевых клеток нестабильность генома проявляется не только высокой вероятностью мутаций и других повреждений ДНК, но и полиморфизмом межгенных микросателлитных последовательностей. В представленной работе описаны результаты исследования, цель которого - использовать ПЦР со случайно выбранными праймерами (AP-PCR), чтобы выяснить, являются ли случаи множественных опухолей полинеопла-зиями или же они имеют метастатическое происхождение. Если опухоли возникли независимо друг от друга, расположение микросателлитных полос у них не будет соответствовать друг другу; если же вторая опухоль - метастаз, будет наблюдаться соответствие микросаттелитов в опухолях, но несоответствие их в нормах.

%

0

В результате сопоставительного анализа аллельного дисбаланса в опухолевых и нормальных тканях исследованных органов были сделаны заключения о природе опухолевого поражения (первично-множественного или метастатического) в каждом из 20 случаев. Анализ профилей мутаций при синхронных эндометриоидных опухолях яичников и эндометрия показал, что в 100% наблюдений опухоли имеют единое клональное происхождение и соответствуют раку тела матки с метастазами в яичниках. По одному образцу опухоли мы представили более подробную информацию, включая наследственные мутации в CTNNB1, PTEN и ARID1A. Мутация ARID1A приводит к сдвигу рамки считывания, что приводит к потере ядерного белка ARID1A в клетках карциномы из обоих участков (но не стромальных клеток, которые служат внутренним положительным контролем). Для сравнения на рис. 2 представлен образец № 54, где опухоли представлены синхронными независимыми первичными карциномами яичников и эндометрия. При сопоставлении результата с гистологическим диагнозом было установлено, что в данном случае речь идет о светлоклеточной аденокар-циноме яичников и эндометриоидном раке тела матки.

Кроме того, при анализе очагов эндометриоза в 8 (80%) из 10 наблюдений отмечалось снижение экспрессии ARID1A, что является одним из первых признаков развития эндометриоидного рака яичников [12].

а Образец №54

Эндометрий ENEC Яичник CCOC Э

Таким образом, исследования тканей атипического эндометриоза с помощью молекулярно-генетического анализа, вероятно, позволят создать группы риска по возникновению некоторых форм рака яичника, в частности эндометриоидной его формы.

Справедливость этого заключения подтверждается проведенными международными исследованиями. Так, Rössing и соавт. утверждают, что, выполняя аднексэкто-мию у больных эндометриозом, они добились снижения числа больных светлоклеточным и эндометриоидным раком яичников [13].

M. Gaudet и соавт. при анализе историй болезни 66 802 пациенток моложе 54 лет, подвергшихся пангис-терэктомии по поводу эндометриоза, отметили снижение общей заболеваемости практически всеми злокачественными опухолями репродуктивной системы [14].

Считается, что только экстирпация матки с придатками приводит к прекращению ретроградного поступления атипических клеток эндометриоза и интраэпителиальной гиперплазии, провоспалительных и канцерогенных агентов во время менструации [15].

В результате этой операции менопауза наступает раньше, снижается концентрация эстрогенов, а если признать справедливой теорию непрерывной овуляции, снижается риск развития рака яичников.

Образец №8 етрий ENEC Яичник ENOC

б №8

№15

№27

Я Э

Я Э

Только яичники

Наследственные (общие)

Только эндометрий

Я Э

шь

_ -À

100 мкм №24

100 мкм

Мутации

Наследственные ■

Найденные только |-1

в яичниках эндометрии I-1

Идентифицированные._

несколькими методами 1—

Я Э

FBXW7 Chr:4:153333123 CA>C CDKN2A Chr:9:21971096 C>T PTEN Chr:10:89712023 G>A PIK3R2 Chr:19:18273147 C>G ARID1A Chr:1:27107012 TC>T . CTNNB1 Chr:3:41266101 C>T PTEN Chr:10:89692904 C>G CTCP Chr:16:67645399 GA>G ARID1A Chr:1:27107012 TC>T CTNNB1 Chr:3:41266101 C>T

Частота аллелей H Ш

0 - 0,25 - 0,5

ARID1A

Образец №8

30 мкм

в

Рис. 2. Молекулярный профиль эндометриоидной аденокарциномы яичников и тела матки.

ENOC - эндометриоидная аденокарцинома яичников, ENEC - эндометриоидная аденокарцинома тела матки,

CCOC - светлоклеточная аденокарцинома яичников

ЗАКЛЮЧЕНИЕ

Таким образом, следует признать, что с эндометрио-зом связано возникновение определенных подтипов рака яичника (преимущественно эндометриоидного и свет-локлеточного) и рака эндометрия. Это позволит выделить группы риска по возникновению этой патологии. Возможно, в дальнейшем следует пересмотреть взгляды

на органосохраняющее лечение у пациенток с эндоме-триоидной аденокарциномой яичников.

Клиницисты должны понимать, что рак яичника является гетерогенным заболеванием с различными морфологическими, молекулярными и эпидемиологическими характеристиками. Более глубокое понимание механизмов различных подмножеств этой болезни необходимо для разработки новых, более эффективных подходов к профилактике, скринингу, диагностике и лечению этой патологии.

СВЕДЕНИЯ ОБ АВТОРАХ

Паяниди Юлия Геннадьевна - доктор медицинских наук, старший научный сотрудник гинекологического отделения ФГБУ «Российский онкологический научный центр им. Н.Н. Блохина» Минздрава России, Москва E-mail: [email protected]

Жорданиа Кирилл Иосифович - доктор медицинских наук, профессор, ведущий научный сотрудник гинекологического отделения ФГБУ «Российский онкологический научный центр им. Н.Н. Блохина» Минздрава России, Москва E-mail: [email protected]

Логинов Виталий Игоревич - кандидат биологических наук, ведущий научный сотрудник лаборатории патогеномики и транскриптомики ФГБНУ «Научно-исследовательский институт общей патологии и патофизиологии», Москва Чемерис Галина Юрьевна - кандидат биологических наук, старший научный сотрудник ФГБУ «Российский онкологический научный центр им. Н.Н. Блохина» Минздрава России, Москва

Сивакова Наталья Геннадьевна - врач-онколог, гинеколог, научный сотрудник гинекологического отделения ФГБУ «Российский онкологический научный центр им. Н.Н. Блохина» Минздрава России, Москва

ЛИТЕРАТУРА

1. Sampson J.A. Heterotopic or misplace endometrial tissue // Am. J. Obstet. Gynecol. 1925. Vol. 10. P. 649.

2. Бохман Я.В., Баскаков В.П., Колосов А.Е. Онкологические аспекты эндометриоза // Акуш. и гин. 1979. № 10. С. 47-49.

3. Brinton L.A., Gridley G., Persson I. et al. Cancer risk after a hospital discharge diagnosis of endometriosis // Am. J. Obstet. Gynecol. 1997. Vol. 176. P. 572-579.

4. Melin A., Sparen P., Persson I. et al. Endometriosis and the risk of cancer with special emphasis on ovarian cancer // Hum. Reprod. 2006. Vol. 21. P. 1237-1242.

5. Жорданиа К.И., Паяниди Ю.Г., Сонова М.М., Савостикова М.В. и др. Эндометриоз и рак яичников. Продолжение темы // Онкогинекология. 2015. № 2. С. 16-24.

6. Сонова М.М., Адамян Л.В., Жорданиа К.И., Паяниди Ю.Г. Эндометриоз и рак яичников. Есть ли взаимосвязь? Общие патогенетические черты рака яичников и эндометриоза // Онкогинекология. 2013. № 4. С. 30-40.

7. Елисеев Д.Э., Огай Д.С., Абакумов Р.С., Холодова Ж.Л. и др. Эндометриоз кишки: диагностика, лечение, онкологические аспекты. Обзор литературы и клиническое наблюдение // Онкогинекология. 2016. № 3. С. 71-76.

8. Cotton R.G.H., Scriver C.R. Proof of «disease causing» mutations // Hum. Mutat. 1998. Vol. 12. P. 1-10.

9. Weissenbach J., Gyapay G., Dib C. et al. A second-generation linkage map of the human genome // Nature. 1992. Vol. 359. P. 794-801.

10. Armour J.A.L., Alegre S.A., Miles S., Williams L.J. et al. Minisatellites and mutation processes in tandemly repetitive DNA // Microsatellites: Evolution and Applications / eds D.B. Goldstein, C. Schlotterer. Oxford : Oxford University Press, 1999. P. 24-33.

11. Charlesworth B/, Sniegowski P/, Stephan W. The evolutionary dynamics of repetitive DNA in eukaryotes // Nature. 1994. Vol. 371. P. 215-220.

12. Yamamoto S., Tsuda H., Takano M., Hase K. et al. Clear-cell adenofibroma can be a clonal precursor for clear-cell adenocarcinoma of the ovary: a possible alternative ovarian clear-cell carcinogenic pathway // J. Pathol. 2008. Sep. Vol. 216, N 1. P. 103-110.

13. Rossing M.A., Cushing-Haugen K.L., Wicklund K.G., Doherty J.A. et al. Risk of epithelial ovarian cancer in relation to benign ovarian conditions and ovarian surgery // Cancer Causes Control. 2008. Vol. 19. P. 1357-1364.

14. Gaudet M.M., Gapstur S.M., Sun J., Teras L.R. et al. Oophorectomy and Hysterectomy and Cancer Incidence in the Cancer Prevention Study-II Nutrition Cohort. // Obstet. Gynecol. 2014 June. Vol. 123, N 6. P. 1247-1255.

15. Жорданиа К.И., Паяниди Ю.Г., Савостикова М.В., Пани-ченко И.В. и др. Некоторые нюансы патогенеза рака яичников // Онкогинекология. 2016. № 1. С. 36-45.

Пограничные опухоли яичников - прогноз после операции

У меня, как и у большинства людей далеких от медицины, понятие об опухолях всегда ассоциировалось с раком. Долгое время я была уверена, что любое новообразование приводит к его разрастанию и дальнейшему летальному исходу. Основная ошибка – относить пограничные опухоли, расположенные в яичниках к смертельным болезням.

Что собой представляет пограничная опухоль яичника

Этот подвид относится к среднему звену, находящемуся в промежутке между безобидной нераковой опухолью и угрожающей жизни раковой. Пограничные варианты формируются из эпителиальных клеточных структур органа, характеризуются симптоматическими проявлениями раковых и нераковых заболеваний. Без проведения полноценной диагностики принадлежность к подвиду определить невозможно.

Опасна ли пограничная опухоль яичника для жизни женщины

Новообразование не относится к жизнеугрожающим вариантам – переход в рак наблюдается в редких эпизодах. При своевременном обращении за профессиональной помощью и адекватной терапии риск повторного образования значительно снижается.

Прогноз пограничной опухоли яичника

Благоприятность прогноза зависит от своевременно проведенного лечения. Хирургическое иссечение опухолевидного процесса на ранних этапах его развития не является препятствием для рождения следующего младенца. Репродуктивная функция женского организма сохраняется, но стопроцентной гарантии на невозможность рецидива не дает ни одна клиника.

Рак пограничных яичников

Злокачественное перерождение исходного опухолевидного процесса регистрируется в ситуациях исключения. Проблема связана с множественными повторными рецидивами заболевания, отказом от хирургической процедуры, слепой верой в народные методики лечения. Спецификация подвида опухоли и ее качественные характеристики проходят при гистологическом анализе тканей аномалии.

Пограничная опухоль яичника после операции

Вторичное возникновение чаще встречается после удаления муцинозной формы пограничной опухоли. Повторяющиеся эпизоды приводят к необходимости резекции матки и ее придатков, с последующим отсутствием возможности к деторождению.

Лечение пограничной опухоли яичников

Подразумевает операционные манипуляции – удаление тела новообразования и частичное иссечение рядом расположенных здоровых тканей. Консервативное лечение не имеет логического смысла.

Ранние формы болезни и их своевременное купирование позволяют сохранить репродуктивное назначение женского организма.

Что входит в диагностику

При проведении обследования организма чаще применяют:

  • ультразвуковой метод;
  • КТ;
  • гистологическое изучение тканей опухоли;
  • исследование крови на присутствие анемических отклонений.

Осложнения

После операции могут встречаться последствия:

  • кровоизлияния внутреннего и внешнего характера;
  • воспаление в забрюшинном пространстве;
  • проблемы со свободным освобождением мочевого пузыря;
  • нагноение швов;
  • сильные боли.

Предрасполагающие факторы

Специалисты предполагают, что болезнь образуется под влиянием наследственной предрасположенности. Ко вторичным источникам ее формирования относят:

  • отклонения в обменных процессах;
  • нарушение работы желудочно-кишечного отдела;
  • воспалительные патологии органов малого таза;
  • экстрагенитальные заболевания во время вынашивания ребенка;
  • отсутствие постоянного полового партнера, эпизодические половые контакты;
  • последствия сложной родовой деятельности.

Таблица виды опухолей и их особенности

Классификация

Имеется большое количество вариаций деления пограничных опухолей, основанных на разнообразных характеристиках. В основе классификации лежит сила разрастания и уровень поражения организма патологией.

Пограничные серозные опухоли яичника

Отклонения регистрируются у 10-15% пациенток – от общего количество эпителиальных опухолей. Среднестатистические данные утверждают, что проблема чаще фиксируется у женского пола в периоде от 35 до 55 лет, в момент стандартного гинекологического обследования.

К отрицательной особенности серозных форм относят их способность к созданию поздних повторов – спустя 20 или 30 лет патологический процесс способен возродиться.

Пограничные муцинозные образования яичника

Встречаются у 15-20% пациенток. Аномальное отклонение не связано с возрастными изменениями и способно к развитию как в двадцать пять, так и в шестьдесят лет. Муцинозная форма чаще развивается в одном яичнике – правостороннем.

Эндометриоидные опухоли яичника

Регистрируются в редких вариантах. Большое количество обнаруженных опухолей представлены промежуточным типом эндометриоидного рака яичников. Данная вариация также повреждает только один из парных органов.

Мезонефроидные новообразования

Светлоклеточные пограничные опухоли фиксируются у 2% пациенток, большая их часть сочетается с эндометриозом. Метастазирование формируется спустя 10-15 лет от начала первичного появления недуга.

Пограничная опухоль Бреннера

Нестандартно растущая пограничная опухоль определяется у женщин в пожилом возрасте. Проблема образуется в климактерическом периоде. Объем новообразования может составлять 15 и более сантиметров. Аномальное отклонение представлено кистой, в теле которой насчитывается больше 20 небольших узелковых формирований.

Симптоматические проявления и первые признаки

Первоначальные этапы развития заболевания не имеют ярких проявлений. Пограничная опухоль обнаруживается при проведении ультразвуковой диагностики состояния органов малого таза. Подтверждающим признаком проблемы является выраженный дискомфорт в районе разрастания тканей.

По мере увеличения пограничного новообразования у пациенток наблюдается следующая характерная симптоматика:

  • приступы тошноты и рвоты после принятия пищи;
  • повышенное газообразование, вздутие живота;
  • боли в поясничной области;
  • апатическое состояние, слабость;
  • резкое снижение веса;
  • стабильные показатели субфебрильной температуры.

От объема опухоли зависит увеличение живота в размерах.

Методы лечения

Заболевание лечиться только хирургическими методами – с полным или частичным удалением яичников. В сложны вариантах течения болезни больным может назначаться иссечение как матки, так и ее придатков. Терапия проходит при помощи лапароскопических и радикальных полостных методик.

Нужна ли химиотерапия

Химиотерапевтическое направление назначается для предотвращения повторного возникновения пограничной опухоли. Количество курсов не превышает четырех единиц и производится по алгоритму:

  • первичный – непосредственно после операции;
  • вторичный – спустя 60 суток;
  • третий – через четыре календарных месяца;
  • четвертый – ровно через полугодие после проведенной процедуры.

Химиотерапия рекомендуется к проведению при определенном типе пограничных опухолей – чаще при эндометриоидном новообразовании.

Профилактика

Специальных методик по предотвращению образования опухолей не разработано. Врачи советуют женщинам внимательно относиться к повседневному образу жизни:

  • перейти на полноценный рацион питания;
  • стабилизировать график труда и отдыха;
  • исключить чрезмерное увлечение алкогольной, слабоалкогольной и табачной продукцией;
  • избегать беспорядочных половых контактов.

Выявление аномального процесса проходит при плановом гинекологическом осмотре, который должен проходить каждое полугодие.

Рецидив

При первой стадии болезни и хирургическом удалении лимфатических узлов и тканей сальника вероятность повторного развития находится на минимальных отметках. Если аномалия дополнится повреждением новообразования, то риск повторного рецидива возрастает в несколько раз.

В большинстве ситуаций опасность представляют муцинозные опухолевидные процессы, без оказания отрицательного влияния на процент выживаемости среди пациентов. При них возрастает необходимость повторных манипуляций. Среднестатистические показатели гарантируют выживаемость практически на 100%.

Возможно ли зачатие и рождение ребенка

Если за основу хирургического вмешательства был взят принцип органосохраняющей методики, то у женского пола сохраняется ежемесячный цикл. Большой процент больных способны к зачатию и последующему вынашиванию ребенка.

Всегда ли необходимы химические препараты

Не все специалисты поддерживают химиотерапию при пограничных опухолях. Как средство монотерапии борьбы с заболеванием она не подходит – особого влияния на объемы новообразования химиопрепараты не оказывают.

Отзывы

По мнению пациенток, своевременное обнаруженная и прооперированная опухоль позволяет вынашивать детей без особых проблем.

Татьяна

«Ближе к 30 годам у меня обнаружили серозный тип пограничной опухоли. Провели операцию, которая сохраняет органы, а через полтора года родился мой первый малыш. Еще через три родила второго, но во время кесарева сечения врачи обнаружили, что заболевание вернулось. На этот раз у меня удалили матку с яичниками».

Светлана

«После операции у меня осталась только треть яичника. Лечащий врач посоветовал не отчаиваться – по его словам, с такой проблемой у него рожают и по двое детей. Так и получилось – спустя три года я родила близнецов. Но на этом моя радость закончилась – пришлось пройти повторную операцию и курс химиотерапии».

Полезно узнать:

Эндометриомы - глубокий эндометриоз яичников

Эндометриоз может проявляться в виде классических имплантатов, расположенных на поверхности одного или обоих яичников, но также может быть обнаружен глубоко внутри них. При глубоком эндометриозе яичников образуются заполненные темной жидкостью полости, которые могут различаться по размеру, известные как эндометриомы или «шоколадные кисты». Диагноз эндометриомы можно заподозрить на основании ультразвукового исследования таза, но окончательный диагноз должен быть основан на микроскопическом исследовании самой кисты.(увидеть ниже).

Эндометриомы могут рассматриваться как наиболее серьезная угроза репродуктивному потенциалу женщины, за исключением раковых опухолей репродуктивного тракта. Эти поражения очень плохо поддаются лечению и могут разрушить всю здоровую ткань яичников, что приведет к преждевременной или ранней недостаточности яичников, проблемам с овуляцией или снижению функции яичников. Эндометриомы также могут привести к инвазивным и деструктивным операциям на тазовых органах, что может вызвать частичную или полную преждевременную потерю функции яичников.Эти кисты могут представлять собой медицинскую дилемму, даже когда женщины получают лечение бесплодия, такое как вспомогательные репродуктивные технологии (ВРТ).

Клинические последствия эндометриом (у женщин репродуктивного возраста)

Эндометриомы могут:

  • Повысить риск рака яичников для женщин репродуктивного возраста
  • Причина тазовой боли
  • Способствуют бесплодию
  • Снижение функции яичников
  • Нарушение вспомогательных репродуктивных технологий

Варианты лечения эндометриом (у женщин репродуктивного возраста)

Не все поставщики медицинских услуг согласны с единым методом лечения эндометриом; однако большинство экспертов считают, что женщин репродуктивного возраста должны лечить специалисты по репродуктивной системе.

  • Наблюдение за симптомами
  • Ультразвуковое наблюдение
  • Лечение
  • Хирургическое лечение - биопсия, дренирование и коагуляция кисты; удаление кисты из яичника; частичное удаление кисты и лазерная абляция

Хирургия

Овариэктомия (удаление яичника, содержащего эндометриому) - это , никогда не вариант для женщин репродуктивного возраста с симптомами, указывающими на эндометриому.

Хотя менее одного процента кист яичников, диагностированных как вероятные эндометриомы при УЗИ у женщин репродуктивного возраста, оказываются злокачественными опухолями, такая возможность все еще существует.Как правило, если киста яичника выглядит как эндометриома на УЗИ, сохраняется и превышает 4 см (по текущим стандартам), операция необходима для исключения злокачественной опухоли. Операция также показана при сильной хронической тазовой боли.

Наблюдение и лечение обычно неэффективны для облегчения симптомов, связанных с эндометриомами. С другой стороны, консервативная хирургия очень эффективна в обеспечении длительного облегчения на 9109.Хирургическое «иссечение» или удаление эндометриомы (эндометриом) также является эффективной операцией по увеличению фертильности у молодых женщин, страдающих бесплодием без другой видимой причины (и которые не привержены вспомогательной репродуктивной технологии). В крупном исследовании сообщается, что частота наступления беременности превышает 50 процентов в течение двух лет после операции по удалению эндометриомы у женщин, участвовавших в исследовании.

Удаление эндометриом не рекомендуется женщинам, планирующим АРТ ( экстракорпоральное оплодотворение ).Хирургическое удаление не оказывает положительного влияния на частоту наступления беременности и может снизить выход яйцеклеток из яичников в этом случае (в зависимости от используемой хирургической техники). Однако в редких случаях рекомендуется операция на эндометриоме даже женщинам, получающим АРТ. К ним относятся следующие:

  • Эндометриома существенно затрудняет извлечение яйцеклеток
  • Эндометриома разорвана или инфицирована во время извлечения яйцеклеток
  • Адекватная стимуляция яичников при ВРТ вызывает сильную боль
  • Эндометриома имеет подозрительные рентгенологические признаки (подозрение на злокачественное новообразование)

Хирургия остается основой современного лечения эндометриом.Тем не менее, количество операций (какая техника используется) и когда она предлагается, может существенно повлиять на конечный успех лечения. Нет никаких сомнений в том, что даже минимально инвазивные, консервативные, стандартные методы удаления эндометриомы могут привести к необратимому повреждению яичника. Бостонский центр эндометриоза - это узкоспециализированный междисциплинарный центр и лидер в области технологических инноваций для изучения новых способов лечения этого сложного состояния (также см. Наш раздел о репродуктивной хирургии с помощью компьютера).Наша цель в лечении эндометриом - сохранить фертильность, обеспечивая при этом безопасное и качественное лечение, которое улучшит репродуктивный успех.

.

Очерки патологии - Эндометриоидная карцинома

Яичник

Эндометриоидные опухоли

Эндометриоидная карцинома


Тема завершена: 1 декабря 2012 г.

Незначительные изменения: 6 марта 2020 г.


Авторские права: 2003-2020, PathologyOutlines.com, Inc.

9002 поиск: Эндометриоидный рак яичника

просмотров страниц в 2019 г .: 19711

просмотров страниц в 2020 г. по настоящее время: 13915

Цитируйте эту страницу: Ehdaivand S.Эндометриоидная карцинома. Сайт PathologyOutlines.com. https://www.pathologyoutlines.com/topic/ovarytumorendometrioidcarcinoma.html. По состоянию на 6 августа 2020 г.

Определение / общее

  • 10–25% первичных карцином яичников
  • 15% сосуществуют с эндометриозом; опухоли могут возникнуть из-за эндометриоидных кист
  • 15 - 30% пациентов имеют синхронную гиперплазию или карциному эндометрия; эти опухоли часто хорошо дифференцируются с плоскоклеточной метаплазией
  • Связаны с кератиновыми гранулемами брюшины, лишенными жизнеспособных клеток; может содержать призраки плоских клеток или кератинового мусора
  • Поиск жизнеспособных опухолевых клеток; но сами по себе гранулемы не меняют стадию или прогноз (Am J Surg Pathol 1990; 14: 925)
  • Средний возраст 51 год, диапазон 26 - 87 лет
  • Классификация: аналогична первичной карциноме эндометрия

Факторы прогноза

  • Лучше, чем серозные / муцинозные опухоли, потому что обычно стадия 1 и хорошо дифференцированы, но при сопоставлении по возрасту, стадии и степени прогноз аналогичен серозному
  • Цитологическая атипия и микроинвазия не влияют на прогноз (Am J Surg Pathol 2000; 24: 1465)
  • Прогноз хуже, чем при пограничных опухолях; может иметь злокачественное поведение при ограниченной деструктивной инвазии в строму (Mod Pathol 2005; 18: 903)
  • Тщательный образец, поскольку компонент серозной или недифференцированной карциномы снижает 5-летнюю выживаемость с 63% (чистый) до 8% (Am J Surg Pathol 1994; 18: 687).
  • Опухоли с компонентом желточного мешка необычно агрессивны (Am J Surg Pathol 1996; 20: 1056).

Общее описание

  • Кистозная, солидная, геморрагическая
  • Папиллярные образования отсутствуют или незаметны
  • 5% двусторонний
  • Среднее значение 11 см, диапазон 3 - 22 см

Изображения брутто


Изображения AFIP

Поверхность яичника и открытой матки

Возникновение эндометриоидной кисты

Предоставлено Ayse Ayhan, M.D.

Двусторонний эндометриоидный рак - слева, 730 г, 14,5 x 12,6 см


.

Очерки патологии - Эндометриоз

Яичник

Другой неопухолевый

Эндометриоз


Тема завершена: 1 августа 2017 г.

Незначительные изменения: 31 мая 2020 г.


Авторские права: 2003-2020, PathologyOutlines.com20, Inc. PubMed Search: Эндометриоз яичников [название]


просмотров страниц в 2019 г .: 25,533

просмотров страниц в 2020 г. по настоящее время: 14,834

Цитируйте эту страницу: Busca A, Parra-Herran C.Эндометриоз. Сайт PathologyOutlines.com. https://www.pathologyoutlines.com/topic/ovarynontumorendometriosis.html. По состоянию на 6 августа 2020 г.

Определение / общее

  • Наличие эктопических желез эндометрия или стромы в яичнике

Основные признаки

  • Доброкачественные, но связанные с повышенным риском светлоклеточного рака яичников и подтипов эндометриоидов
    • Имеет некоторые перекрывающиеся молекулярные изменения со светлоклеточными и эндометриоидными карциномами ( мутации PI3KCA, ARID1A, p53 )
  • Кроме того, было продемонстрировано, что эндометриоз у пациентов без рака несет онкогенные мутации в ARID1A, PIK3CA, KRAS и PPP2R1A , что в некоторых случаях свидетельствует о неопластической природе (N Engl J Med 2017; 376: 1835)
  • Иммуногистохимический анализ CD10, используемый для подтверждения наличия стромы эндометрия в случаях, не очевидных по морфологии

Терминология

  • Эндометриома, шоколадная киста, эндометриоидная киста, киста эндометрия

Участки

  • Яичники являются наиболее частым участком, за ними следуют задний тупик, широкая связка, маточно-крестцовая связка, ректосигмовидная кишка и мочевой пузырь.
.

Смотрите также